Pasadofuturo.com Energia Piramidal Astrologia Nueva Medicina Germanica Leyes Biológicas Reencarnacion Vidas Pasadas Origen Humanidad Venta Piramides Energeticas
Nueva Medicina Germanica Hamer Leyes Biologicas 5LB Clases Particulares Presenciales Escuela Aprender Estudiar Cursos Seminarios Conferencias Formacion Ciudad Mexico Profesional Medicina Salud Noviembre Intensivo
Nueva Medicina Germanica Hamer Leyes Biologicas 5LB Clases Particulares Presenciales Escuela Aprender Estudiar Cursos Seminarios Conferencias Formacion Ciudad Mexico Profesional Medicina Salud Noviembre Intensivo
.
Dr Jesus Yeo Nueva Medicina Germanica Leyes Biologicas NMG Hamer Biodecodificacion Guadalajara Jalisco Mexico Consultas Medicas Salud
Piramides Energeticas Pasadofuturo.com Energia Piramidal Venta Compra Salud Meditacion
Nueva Medicina Germanica Hamer Leyes Biologicas 5LB Clases Particulares Presenciales Escuela Aprender Estudiar Cursos Seminarios Conferencias Mexico Jalisco Guadalajara Formacion Profesional Medicina Salud Virtual Virtuales Internet
Skype Guadalajara Jalisco Mexico Nueva Medicina Germanica Leyes Biologicas 5LB NMG Consultas Gabriela Rebeca Macias Lira Asesoria Terapia

El Verdadero Origen de la Humanidad

Zecharia Sitchin Anunnaki Nibiru Libro Codigo Cosmico Capitulo 7
Zecharia Sitchin Anunnaki Nibiru Libro Codigo Cosmico Capitulo 7
Zecharia Sitchin Anunnaki Nibiru Libro Codigo Cosmico Capitulo 7

Esta sección está basada principalmente en los descubrimientos del sabio Zecharia Sitchin sobre la historia de nuestro planeta y el origen y desarrollo de la Humanidad. Sitchin nos dejó un legado invaluable de 15 libros de su serie: "Crónicas de la Tierra", basados en la Biblia, las tablillas de arcilla, los mitos de la antigüedad y los descubrimientos arqueológicos.

Zecharia Sitchin fue un gran arqueólogo y profundo conocedor del hebreo, de las lenguas semíticas y europeas, del Antiguo Testamento y de la Historia y la Arqueología del Oriente Próximo. Fue además uno de los pocos eruditos que entienden el Sumerio. Sitchin estudió en la London School of Economics and Political Science, y se licenció en la Universidad de Londres. Sus obras han sido traducidas a 14 idiomas, publicadas en ediciones de bolsillo y hasta en Braille para invidentes.

El Código Cósmico

Zecharia Sitchin Anunnaki Nibiru Libro Codigo Cosmico Capitulo 7

Capítulo 7
Conocimientos secretos, textos sagrados

La ciencia, la comprensión de las obras de los cielos y la Tierra, era posesión de los dioses; así lo creían, inequívocamente, los pueblos de la antigüedad. Era un "secreto de los dioses", algo que se ocultaba de la Humanidad o se revelaba, de vez en cuando y sólo parcialmente, a individuos elegidos, iniciados en los secretos divinos.

"Todo lo que sabemos nos lo enseñaron los dioses", afirmaban los sumerios en sus escritos; y en esto se hallan los fundamentos, a lo largo de milenios hasta nuestros tiempos, de la ciencia y la religión, de lo descubierto y de lo oculto.

En primer lugar, estaban los Conocimientos Secretos; lo que fue revelado cuando se le concedió a la Humanidad el entendimiento se convirtió en Sabiduría Sagrada, el fundamento de las civilizaciones humanas y del progreso.

En cuanto a los secretos que los dioses habían guardado para sí mismos, ésos, al final, demostraron ser de lo más devastador para la Humanidad. Y uno debe comenzar a preguntarse si la interminable búsqueda de Lo Que Está Oculto, disfrazado a veces de misticismo, no provendrá del deseo de alcanzar lo divino, pero desde el temor de cuál es el Hado que los dioses, en sus conclaves secretos o en sus códigos ocultos, tienen destinado para la Humanidad.

Algunos de los conocimientos que se impartieron, o pudieron impartirse, a la Humanidad cuando se le concedió la Sabiduría y el Entendimiento se pueden recoger del reto que Dios le plantea a Job respecto a lo que no sabe (pero Dios sí). "
Di si conoces la ciencia", le dice el Señor bíblico al sufriente Job:

¿Quién ha medido la Tierra, para que se conozca?
¿Quién ha extendido una cuerda sobre ella?
¿Qué forjó sus plataformas?
¿Quién ha puesto su piedra angular?
¿De dónde viene la Sabiduría, y dónde se ubica el Entendimiento?
Los mortales no conocen sus procesos,
en la tierra de los vivos no se encuentra.
Sus caminos, de los Elohim son conocidos,
Dios conoce su lugar;
pues ve hasta los confines de la Tierra
y contempla todo lo que está bajo los Cielos.

Con estas palabras desafía el Señor bíblico a Job (en el capítulo 28) para que deje de cuestionarse sobre las razones de su Hado, o su objetivo último; pues los conocimientos del Hombre (sabiduría y entendimiento) quedan tan lejos de los de Dios, que no tiene sentido preguntar o intentar comprender la voluntad divina.

El tratamiento que se le daba en la antigüedad a la sabiduría y el entendimiento de los secretos de los cielos y la Tierra (de la ciencia) como dominio divino al cual sólo unos pocos mortales elegidos podían tener acceso, no sólo encontró su expresión en los escritos canónicos, sino también en un misticismo judío como el de la Kabbalah, según la cual la Presencia Divina, simbolizada por la Corona de Dios, descansa en los penúltimos soportes, designados sabiduría (Hojmah) y entendimiento (Binah).
Son los mismos componentes del conocimiento científico a los que fue desafiado Job.

Zecharia Sitchin Anunnaki Nibiru Libro Codigo Cosmico Capitulo 7

Las referencias a Hojmah (sabiduría) en el Antiguo Testamento revelan que ésta se tenía por haber sido un regalo de Dios, puesto que fue el Señor del Universo el que poseía la sabiduría requerida para crear los cielos y la Tierra.

"Cuan grandes son tus obras, Oh Señor; con sabiduría las has forjado todas", dice el Salmo 104 cuando describe y ensalza, fase por fase, la obra del Creador. La Biblia sostiene que, cuando el Señor le concedió la sabiduría a los humanos elegidos, compartió con ellos de hecho los conocimientos secretos relativos a los cielos y la Tierra y a todo lo que está sobre la Tierra. El Libro de Job hablaba de estos conocimientos como de "secretos de sabiduría" que no se le habían revelado a él.

La Revelación, el compartir con la humanidad los conocimientos secretos a través de iniciados elegidos, tuvo sus orígenes antes del Diluvio.

A Adapa, el descendiente de Enki al cual se le concedieron sabiduría y entendimiento (pero no Vida Eterna), no le mostró Anu las extensiones de los cielos simplemente como una visión abrumadora. Las referencias posdiluvianas a esto le atribuyen a él la autoría de una obra conocida como Escritos referentes al tiempo, (del) divino Anu y el divino Enlil, un tratado sobre el cálculo del tiempo y el calendario.

Por otra parte, El relato de Adapa menciona específicamente que a él se le enseñaron, ya de vuelta en Eridú, las artes de la medicina y la curación. Así pues, Adapa fue un científico consumado, adepto tanto en temas celestes como terrestres; también fue ungido como el Sacerdote de Eridú, quizás el primero en combinar ciencia y religión.

Las anotaciones sumerias hablan de otro elegido antediluviano que fue iniciado en los secretos divinos al ser llevado a la morada celestial de los Anunnaki. Éste venía de Sippar (Ciudad Pájaro), dominio de Utu/Shamash, y fue probablemente un descendiente de él, un semidiós. Conocido en los textos como EN.ME.DUR.ANNA, así como EN.ME.DUR.AN.KI (Maestro de las Tablillas Divinas Concernientes a los Cielos o Maestro de las Tablillas Divinas del Enlace Cielo-Tierra), también a él lo elevaron para enseñarle los conocimientos secretos.

Sus padrinos y maestros fueron los Dios es Utu/Shamash e Ishkur/Adad:

Shamash y Adad ( ¿lo vistieron? ¿lo ungieron?)
Shamash y Adad lo pusieron en un gran trono dorado.
Le mostraron cómo observar el aceite y el agua, un secreto de Anu, Enlil y Ea.
Le dieron una tablilla divina, el Kibbu, un secreto del Cielo y la Tierra.
Pusieron en su mano un instrumento de cedro, el favorito de los grandes dioses.
Le enseñaron a hacer cálculos con números.

Aunque en El relato de Adapa no se dice de forma explícita, parece que a Adapa se le permitió, si no fue en realidad un requerimiento, compartir parte de sus conocimientos secretos con sus semejantes humanos, porque si no, ¿para qué escribió su famoso libro? En el caso de Enmeduranki, también se le comisionó la transmisión de los secretos aprendidos, pero con la condición estricta de que se tenía que limitar al linaje de los sacerdotes, de padre a hijo, comenzando por Enmeduranki: "El sabio erudito que guarda los secretos de los grandes dioses atará a su hijo preferido con un juramento ante Shamash y Adad. Con la Tablilla Divina, con un estilo, le instruirá en los secretos de los dioses."

La tablilla en la cual se inscribió este texto (guardada ahora en el Museo Británico) tiene una nota final: "Así se creó el linaje de los sacerdotes, aquéllos a los que estaba permitido acercarse a Shamash y Adad".

En la Biblia se registró también la ascensión al cielo del patriarca antediluviano Henoc, el séptimo de los diez listados, igual que Enmeduranki en la Lista de los Reyes Sumerios. De esta extraordinaria experiencia, la Biblia sólo dice que a la edad de 365 años Henoc fue llevado a lo alto para estar con Dios.

Afortunadamente, el extrabíblico Libro de Henoc, transmitido a través de los milenios y que ha sobrevivido en dos versiones, proporciona muchos más detalles; ¿hasta qué punto es un reflejo del original y hasta qué punto hay fantasía y especulación de la época en que se compilaron los "libros", cerca de los comienzos de la era cristiana?, no podemos saberlo. Pero sus contenidos merecen un resumen, aunque no sea más que por su afinidad con el relato de Enmeduranki, y también por abreviar otro libro extrabíblico, el Libro de los Jubileos, mucho más extenso.

A partir de estas fuentes emerge que Henoc no hizo uno, sino dos viajes celestiales. En el primero se le enseñaron los Secretos del Cielo, y se le dieron instrucciones para que impartiera estos conocimientos a sus hijos a su regreso a la Tierra. En su ascenso hacia la Morada Divina, pasó por una serie de esferas celestes. Desde el lugar del Séptimo Cielo pudo ver la forma de los planetas; en el Octavo Cielo pudo discernir las constelaciones. El Noveno Cielo era el "hogar de los doce signos del Zodiaco".
Y en el Décimo Cielo estaba el Trono Divino de Dios.

Zecharia Sitchin Anunnaki Nibiru Libro Codigo Cosmico Capitulo 7

Habría que decir aquí que la morada de Anu, según los textos sumerios, estaba en Nibiru, al cual hemos identificado como el décimo planeta de nuestro Sistema Solar.

En las creencias de la Kabbalah, el camino hacia la morada de Dios Todopoderoso llevaba a través de diez Sefirot, traducidas como "brillanteces", pero representadas realmente como diez esferas concéntricas, en las cuales la central recibe el nombre de Yessod (Fundamento), la octava y la novena, Binah y Hojmah, y la décima, Ketter, la "Corona" del Dios Altísimo. Más allá se extiende Ein Soff, el "Infinito".

Acompañado por dos ángeles, Henoc llegó hasta su destino final, la Morada de Dios. Allí se le quitaron sus vestiduras terrestres; se le vistió con vestiduras divinas y fue ungido por los ángeles (al igual que se hizo con Adapa). Por mandato del Señor, el arcángel Pravuel sacó "los libros del depósito sagrado" y le dio un estilo de caña con el cual escribir lo que el arcángel le dictaría.

Durante treinta días y treinta noches, Pravuel dictó y Henoc escribió, "los secretos de las obras del cielo, de la Tierra y de los mares; y de todos los elementos, sus pasos e idas, y los estruendos del trueno; y (los secretos) del Sol y la Luna, y las idas y los cambios de los planetas; las estaciones y el año y los días y las horas... y todas las cosas de los hombes, las lenguas de cada canción humana... y todas las cosas convenientes de aprender".

Según el Libro de Henoc, todos estos vastos conocimientos, "secretos de los ángeles y de Dios", se escribieron en 360 libros sagrados, que Henoc llevó con él hasta la Tierra. Reunió a sus hijos, les mostró los libros y les explicó su contenido. Aún estaba hablando e instruyéndoles cuando cayó una oscuridad repentina, y los dos ángeles que habían traído de vuelta a Henoc lo elevaron y lo devolvieron a los cielos; fue precisamente el día y la hora de su 365 cumpleaños.

La Biblia (Génesis 5,23-24) dice simplemente: "Y todos los días de Henoc fueron trescientos y sesenta y cinco años; y Henoc anduvo con Dios, y desapareció porque se lo llevaron los Elohim."

En los tres relatos (Adapa, Enmeduranki y Henoc) se observa una destacada similitud: la de que dos seres divinos están implicados en la experiencia celestial. Adapa fue recibido ante la Puerta de Anu, y acompañado para entrar y salir, por dos jóvenes dioses, Dumuzi y Gizidda; los padrinos/maestros de Enmeduranki fueron Shamash y Adad; y los de Henoc, dos arcángeles.

Estos relatos fueron, no cabe duda, la inspiración de una representación asiría de la puerta celeste de Anu, la cual está custodiada por dos Hombres Águila. La puerta lleva el símbolo de Nibiru, el Disco Alado, y su ubicación celeste viene indicada por los símbolos celestiales de la Tierra (como el séptimo planeta), la Luna y todo el Sistema Solar.

Otro aspecto que destaca, aunque no de forma tan explícita en el caso de Henoc, es la tradición de que la concesión de la sabiduría y el entendimiento convirtió al individuo elegido no sólo en un científico, sino también en sacerdote, además de progenitor de un linaje sacerdotal. Vemos empleado este principio en el desierto del Sinaí, durante el Éxodo, cuando Yahveh, el Señor bíblico, elige a Aarón (hermano de Moisés) y a sus hijos para ser los sacerdotes del Señor (Éxodo 28,1).

Distinguidos ya por pertenecer a la tribu de Leví (tanto por parte del padre como por parte de la madre, Éxodo 2,1), Moisés y Aarón fueron iniciados en los poderes mágicos que les permitían realizar milagros, así como desencadenar las calamidades con las que se pretendió convencer al faraón para que dejara ir a los israelitas.

Zecharia Sitchin Anunnaki Nibiru Libro Codigo Cosmico Capitulo 7

Aarón y sus hijos fueron más tarde santificados (subieron de categoría, hablando claro) para convertirse en sacerdotes, dotados de unas considerables dosis de sabiduría y entendimiento. El Libro del Levítico arroja luz sobre algunos de los conocimientos que se les concedieron a Aarón y a sus hijos; entre ellos se incluían los secretos del calendario (bastante complejos, dado que era un calendario solar-lunar), de las dolencias humanas y su curación, y conocimientos veterinarios.

Se incluía considerable información anatómica en los capítulos relevantes del Levítico, y no se puede descartar la posibilidad de que a los sacerdotes israelitas se les dieran lecciones "prácticas", a la vista del hecho de que los modelos de arcilla de partes anatómicas, inscritos con instrucciones médicas, eran corrientes en Babilonia ya antes de la época del Éxodo .

La Biblia dice del rey Salomón que era "el más sabio de los hombres", que podía pronunciar un discurso sobre la biodiversidad de todas las plantas, "desde los cedros del Líbano hasta el hisopo que crece en los muros, y animales, y pájaros, y cosas que se arrastran, y peces".
Y todo esto porque, además de la sabiduría y el entendimiento (inteligencia) dados por Dios, también adquirió Da'ath, conocimientos eruditos.

Zecharia Sitchin Anunnaki Nibiru Libro Codigo Cosmico Capitulo 7

El linaje sacerdotal iniciado con Aarón estaba sujeto a leyes rigurosas que imponían limitaciones maritales y de procreación. No podían mantener relaciones sexuales, y mucho menos casarse, con cualquiera; pues se requería que "la simiente sacerdotal no sea profanada", y si la simiente de alguno fuera imperfecta (tuviera una mancha, una mutación, un defecto genético) se le prohibía para todas las generaciones el realizar tareas sacerdotales, "pues Yo, Yahveh, he santificado el linaje sacerdotal" de Aarón.

Estas condiciones tan estrictas han venido intrigando a generaciones de expertos bíblicos; pero su verdadera importancia sólo se hizo evidente con el advenimiento de las investigaciones sobre el ADN. En enero de 1997, en la revista Nature, un grupo internacional de científicos dieron cuenta de la existencia de un "gen sacerdotal" entre los judíos cuyo linaje se podía remontar hasta Aarón. Las inalterables tradiciones judías exigen que determinados rituales y bendiciones pronunciadas durante los servicios del Sabbath y de las grandes festividades sean realizados únicamente por un cohén.

Este término, que significa "sacerdote", se utilizó por vez primera en la Biblia para designar a Aarón y a sus hijos. Desde entonces, esta designación ha ido pasando de padres a hijos a través de las generaciones, y la única manera de convertirse en un Cohén es siendo hijo de uno de ellos. Este estatus privilegiado se ha identificado muchas veces con la utilización de "Cohén" como apellido (transmutado en Kahn, Kahane, Kuhn) o como adjetivo añadido tras el nombre de pila, Ha-Cohen, "el sacerdote".

Fue este aspecto de la naturaleza patrilineal de la tradición judía cohén la que intrigó a un equipo de investigación de Israel, Inglaterra, Canadá y Estados Unidos. Centrándose en el cromosoma masculino (Y), que pasa de padre a hijo, pusieron a prueba a centenares de "Cohens" en diferentes países y descubrieron que, en general, tenían dos "señales" únicas en el cromosoma.

Éste demostró ser el caso tanto para los judíos askenazíes (de Europa del Este) como para los sefardíes (Oriente Próximo/África), que se diversificaron tras la destrucción del Templo de Jerusalén en el 70 d.C, indicando la antigüedad de las señales genéticas. "La explicación más simple y directa es que estos hombres tienen el cromosoma Y de Aarón", explicó el doctor Karl Skorecki, del Instituto de Tecnología de Israel, en Haifa.

Los relatos de aquellos que fueron iniciados en los conocimientos secretos afirman que la información se escribió en "libros". Indudablemente, no se trata de lo que ahora llamamos "libros", un buen montón de páginas escritas y encuadernadas. Hay muchos textos que se han descubierto en las cuevas cercanas al mar Muerto, en Israel, y que son conocidos como los manuscritos del mar Muerto. Estos textos están inscritos sobre hojas de pergamino (hechas en su mayor parte de piel de cabra) cosidas y enrolladas, del mismo modo que están inscritos y enrollados hasta el día de hoy los Rollos de la Ley (los cinco primeros libros de la Biblia hebrea).

Los profetas bíblicos (especialmente Ezequiel) destacaron los pergaminos como parte de los mensajes dados por la divinidad. Los antiguos textos egipcios se escribieron en papiros, hojas hechas a partir de una especie de juncos que crecen en el río Nilo. Y los textos más antiguos conocidos, los de Sumer, se inscribieron sobre tablillas de arcilla; utilizando un estilo de caña, el escriba hacía marcas sobre un trozo de arcilla húmeda que, después de secarse, se convertía en una dura tablilla inscrita.

¿En qué forma se escribieron los "libros" de Adapa, Enmeduranki y Henoc (¡360 de ellos este último!)? Teniendo en cuenta que se les atribuye una época anterior al Diluvio (miles de años antes incluso de la civilización sumeria), probablemente ninguno de ellos se escribiera en las formas posdiluvianas, aunque el rey asirio Assurbanipal alardeaba de que podía leer "escritos de antes del Diluvio". Dado que, en cada uno de estos casos, lo que se escribió fue dictado por el Señor divino, sería lógico preguntarse si lo escrito fue hecho en lo que algunos textos sumerios y acadios llaman Kitab Ilani, "escrito de los dioses".

Se pueden encontrar referencias a estos escritos de los propios Anunnaki, por ejemplo, en inscripciones que tratan de la reconstrucción de templos en ruinas, en los cuales se afirmaba que la reconstrucción seguía "los dibujos de antaño y los escritos del Cielo Superior". Los sumerios citaban a una diosa, Nisaba (a veces llamada Nidaba), como patrona de los escribas, además de ser la que conservaba los registros de los dioses; su símbolo era el Estilo Sagrado.

Una de las referencias a escritos de los dioses en tiempos primitivos se encontró en un texto hitita apodado por los expertos como El Canto de Ullikummis. Escrito sobre tablillas de arcilla que se descubrieron en la antigua capital hitita de Hattusa (cerca de la actual población de Boghaskoy, en el centro de Turquía), es el desconcertante relato de "un vigoroso dios hecho de piedra diorita", que un antiguo dios, al cual los hititas llamaban Kumarbis, había forjado con el fin de desafiar a otros dioses.

Éstos, incapaces de soportar el desafío de Ullikummis o de responder a él, se apresuraron a ir a la morada de Enki en el Mundo Inferior para obtener las ocultas "tablillas antiguas con las palabras del hado". Pero, después de abrir el "antiguo almacén", y tras quitar los "sellos de antaño" con los cuales se habían asegurado las tablillas, se descubrió que el escrito estaba en "las palabras de antaño", precisando de los dioses de antaño para comprenderlas.

En Egipto fue a Thot a quien se veneró como el Escriba Divino. Fue él quien tras el Consejo de los Dioses decidió reconocer a Horus como heredero legítimo e inscribió el Decreto de los Dioses en una tablilla de metal, que sería alojada después en la "Cámara de Registros divina". Además de los registros de uso divino, los egipcios también le acreditaban a Thot el haber escrito libros de guía para los mortales. Sostenían que El Libro de los Muertos lo había "escrito Thot con sus propios dedos" como una guía para el Viaje a la Otra Vida.

En una obra más corta, que los egipcios llamaban El Libro de los Alientos, aparecía también la afirmación de que fue Thot quien "había escrito este libro con sus propios dedos". Y en los Relatos de los Magos, al cual ya hemos hecho referencia, se dice que aquel rey y aquella reina a los que Thot había castigado manteniéndolos vivos pero inanimados custodiaban, en una cámara subterránea, "el libro que el Dios Thot había escrito con su propia mano", y en el cual se revelaban conocimientos secretos concernientes al Sistema Solar, la Astronomía y el calendario. Cuando el buscador de tales "libros antiguos de escritos sagrados" entraba en la cámara subterránea, veía que el libro "desprendía una luz, como si el Sol brillara allí".

¿Qué eran esos "libros" divinos y que clase de escritos había en ellos?

El nombre-epíteto de Enmeduranna, "Maestro de las Tablillas Divinas Concernientes al Cielo", llama la atención sobre el término ME de su nombre, traducido aquí como "Tablillas Divinas". Ciertamente, nadie puede estar seguro de qué eran los ME, si eran tablillas o era algo más bien parecido a los discos o los chips de memoria de un ordenador. Eran objetos lo suficientemente pequeños como para llevarlos en una mano, pues se dice que Inanna/Ishtar, con la intención de elevar a su ciudad, Uruk, al rango de capital, obtuvo con estratagemas de Enki montones de ME en los que se hallaban codificados los secretos del Señorío Supremo, la Realeza, el Sacerdocio y otros aspectos de una civilización elevada.

Y recordemos también que el malvado Zu robó en el Duranki de Enlil las Tablillas de los Destinos y los ME en donde estaban codificadas las Fórmulas Divinas. Quizá podamos hacernos una idea de lo que podían ser si nos imaginamos una tecnología unos milenios más avanzada.

Dejando a un lado la cuestión de los escritos y del manejo de datos de los dioses para sus propios propósitos, el tema de qué lengua y qué sistema de escritura se utilizaban cuando se dictaban los conocimientos secretos a los terrestres para uso de terrestres se convierte en un asunto de gran importancia en lo tocante a la Biblia, y específicamente en lo referente a los acontecimientos del Monte Sinaí.

Hay ciertos paralelismos entre el relato de Henoc, que permanece en la morada celestial "treinta días y treinta noches" escribiendo al dictado, y el relato bíblico de Moisés, que asciende hasta el Señor Dios en la cima del Monte Sinaí, "
permaneció allí con Yahveh cuarenta días y cuarenta noches, no comió pan, ni bebió agua, y escribió sobre las tablillas las palabras de la Alianza y los Diez Mandamientos", mientras Dios le dictaba (Éxodo 34,28).

Sin embargo, éste era el segundo juego de tablillas que reemplazaba al primer juego que Moisés estrelló contra el suelo, iracundo, cuando bajó del Monte Sinaí en una ocasión previa. La Biblia proporciona detalles mayores (e increíbles) referentes al primer caso de escritos sagrados; después, la Biblia afirma explícitamente, ¡el mismo Dios hizo la inscripción!

El relato comienza en el capítulo 24 del libro del Éxodo, cuando Moisés, Aarón y dos de sus hijos, y setenta de los Ancianos de Israel, fueron invitados a aproximarse al Monte Sinaí, en cuyo pico el Señor había aterrizado en su Kabod.
Allí, los dignatarios pudieron atisbar la presencia divina a través de una espesa nube, que resplandecía como un "fuego devorador". Después, únicamente Moisés fue llamado a la cima de la montaña, para recibir la Torah (las "Enseñanzas") y los Mandamientos que el Señor Dios había escrito ya:

Y Yahveh dijo a Moisés:
Ven hasta mí sobre el Monte
y permanece allí,
y te daré las tablillas de piedra,
las Enseñanzas y los Mandamientos
que Yo he escrito,
para que puedas enseñarles.
Éxodo 24,12

"Y Moisés entró en mitad de la nube, y ascendió al Monte; y permaneció allí cuarenta días y cuarenta noches".
Después, Yahveh le dio a Moisés, cuando hubo terminado de hablar con él, las dos Tablillas del Testimonio, tablillas de piedra, inscritas con el dedo de Elohim. Éxodo 31,17.

En Éxodo 32,16-17, se proporciona información adicional, ciertamente sorprendente, respecto a las tablillas y al modo en que fueron inscritas. Aquí se describen los acontecimientos que tuvieron lugar cuando Moisés estaba bajando del monte, tras una larga e inexplicable (para el pueblo) ausencia: "Y Moisés volvió a bajar del Monte, y las dos Tablillas del Testimonio en su mano, tablillas inscritas en ambos lados, inscritas por un lado y por el otro. Y las tablillas eran obra de los Elohim, y lo escrito era escritura de Elohim, y estaba grabado en las tablillas".

¡Dos tablillas hechas de piedra, realizadas a mano por la divinidad. Inscritas por delante y por detrás con la "escritura de los Elohim", que debe significar tanto lengua como escritura; y grabada en la piedra por el mismo Dios! Y todo eso en una lengua y una escritura que Moisés podía leer y comprender, pues él les había enseñado todo eso a los israelitas...

Como sabemos por el resto de este registro bíblico, Moisés estrelló las dos tablillas al llegar al campamento y ver que, en su ausencia, el pueblo había hecho un becerro de oro para adorarlo, imitando las costumbres egipcias.
Cuando pasó la crisis, Yahveh le dijo a Moisés: "Talla tú mismo dos tablillas de piedra como las dos primeras, y Yo escribiré sobre esas tablillas las palabras que había en las primeras tablillas que tú has roto. Éxodo 34,1.

Y Moisés hizo esto y subió de nuevo al monte. Una vez allí, Yahveh bajó hacia él, y Moisés se postró y repitió sus súplicas de perdón. En respuesta, el Señor Dios le dictó mandamientos adicionales, diciendo: "Escribe estas palabras, pues según ellas haré una alianza contigo y con el pueblo de Israel." Y Moisés permaneció en el monte cuarenta días y cuarenta noches, anotando en las tablillas "las palabras de la Alianza y los Diez Mandamientos" (Éxodo 35,27-28). Esta vez, Moisés estaba escribiendo al dictado.

Desde el principio no sólo se tuvieron por escritos sagrados las secciones del Éxodo, el Levítico y el Deuteronomio, donde se registran las Enseñanzas y los Mandamientos, sino la totalidad de los cinco primeros libros de la Biblia hebrea (los tres libros de arriba más el Génesis y Números). Reunidos bajo el término general de Torah, también se les conoce como Los Cinco Libros de Moisés, debido a la tradición que dice que el propio Moisés los escribió o fue su autor a través de la revelación divina.

Por tanto, los rollos de la Torah que se sacan de su arca en las sinagogas y se leen en el Sabbath y en las grandes festividades deben ser copiados (por escribas especiales) con toda precisión, del modo en que se han transmitido a lo largo de los siglos: libro por libro, capítulo por capítulo, versículo a versículo, palabra por palabra, letra por letra. Un error en una sola letra descalifica la totalidad del rollo y sus cinco libros.

Mientras que los sabios judíos y los expertos bíblicos han venido estudiando esta precisión de letra por letra a lo largo de los siglos (mucho antes que el interés posterior en los "códigos secretos" de la Torah), se ha ignorado por completo un aspecto aún más intrigante de tan largo y extenso dictado y de la exigida precisión del letra-por-letra: y es que el método de escritura que se utilizó en el Monte Sinaí no pudo haber sido el de la lenta escritura cuneiforme de Mesopotamia, que normalmente utilizaba el estilo sobre la arcilla húmeda, ni tampoco la monumental escritura jeroglífico pictórica de Egipto. ¡El volumen, la rapidez y la precisión letra-por-letra requerían de una escritura alfabética!

El problema es que, en la época del Éxodo, hacia el 1450 a.C, no existía en ninguna parte del mundo antiguo una escritura alfabética.

El concepto del alfabeto es la obra de un genio; y fuera quien fuera ese genio, lo basó en los fundamentos existentes. La escritura jeroglífica egipcia pasó de las imágenes-signos que representaban objetos a los signos que significaban silabas o, incluso, consonantes; pero seguía siendo un complejo sistema de escritura de innumerables imágenes-signos. La escritura sumeria pasó de sus originales pictografías a marcas cuneiformes, y los signos adquirieron un sonido silábico; pero para formar a partir de ellos un vocabulario hacían falta cientos de signos diferentes.

El genio combinó la facilidad cuneiforme con los avances egipcios hacia las consonantes, ¡y lo consiguió con sólo veintidós signos!

Zecharia Sitchin Anunnaki Nibiru Libro Codigo Cosmico Capitulo 7

Comenzando con esto, el ingenioso inventor se preguntó a sí mismo, así como a su discípulo: ¿cuál es la palabra para lo que tú ves? La respuesta, en la lengua de los semitas israelitas, fue Aluf. Estupendo, dijo el inventor: vamos a llamarle a este símbolo Alef , y pronúncialo simplemente como "A". Después dibujó la pictografía de casa. ¿Cómo llamas a esto?, preguntó, y el discípulo contestó: Bayit. Estupendo, dijo el inventor, de ahora en adelante le llamaremos a este signo "Beth", y pronúncialo simplemente como "B".

ón tuviera lugar en la realidad, pero estamos seguros de que éste fue el proceso de creación y de invención del Alfa-Bet-o. La tercera letra, Gimel (pronunciada "G") era la imagen de un camello (Gamal en hebreo); la siguiente, Daleth, la "D", representaba Deleth, "puerta" (sobre sus bisagras); y así hasta las veintidós letras del alfabeto semita, todas las cuales sirven como consonantes y tres de las cuales pueden desdoblarse como vocales.

¿Quién fue el ingenioso innovador?

Zecharia Sitchin Anunnaki Nibiru Libro Codigo Cosmico Capitulo 7

Si tenemos que aceptar la opinión de los eruditos, fue algún trabajador manual, un esclavo de las minas de turquesa egipcias del Sinaí occidental, cerca del mar Rojo, porque fue allí donde Sir Flinders Petrie encontró, en 1905, unos signos tallados en las paredes que, una década más tarde, Sir Alan Gardiner descifraría como "acrofónicos", deletreado L-B-A-L-T; significaba Dedicado "A la Señora" (supuestamente la Dios a Hathor), ¡pero en semita, no en egipcio!

Escritos similares posteriores descubiertos en esa región no dejan lugar a dudas de que el alfabeto se originó allí; desde aquí se difundió hasta Canaán y, luego, hasta Fenicia (donde hubo un intento por expresar esta ingeniosa idea con signos cuneiformes, pero no duró mucho).

Bellamente ejecutada, la "escritura sinaítica" original sirvió como escritura del Templo en Jerusalén y como escritura real de los reyes de Judea hasta que fue sustituida, durante la época del Segundo Templo, por una escritura cuadrada que se tomó prestada de los árameos, la escritura utilizada en los manuscritos del mar Muerto, la que ha llegado hasta los tiempos modernos.

Zecharia Sitchin Anunnaki Nibiru Libro Codigo Cosmico Capitulo 7

Nadie se ha sentido cómodo con la atribución de la revolucionaria innovación, a finales de la Edad del Bronce, a un esclavo de las minas de turquesa. Hacían falta conocimientos prominentes de habla, escritura y lingüística, además de unos destacados sabiduría y entendimiento, que difícilmente habría podido poseer un simple esclavo.

Y, además, ¿cuál podría haber sido el propósito para inventar una nueva escritura cuando, en las mismas regiones mineras, monumentos y muros estaban llenos de inscripciones jeroglíficas egipcias? ¿Cómo pudo una oscura innovación en una región prohibida difundirse hasta Canaán y más allá, y sustituir allí un método de escritura que ya existía y que había servido bien durante más de dos milenios? Esto no tiene sentido; pero, a falta de otra solución, se mantiene la teoría.

Zecharia Sitchin Anunnaki Nibiru Libro Codigo Cosmico Capitulo 7

Pero, si hemos imaginado bien la conversación que llevó a este alfabeto, entonces fue a Moisés a quien se le dio la primera lección. Fue en el Sinaí; él estaba allí justo en aquellos tiempos; se dedicó a hacer amplio uso de la escritura; y tuvo al maestro supremo: el mismo Dios.

Pocos se han dado cuenta de que en los relatos bíblicos del Éxodo se encuentra el hecho de que Moisés fue instruido por Yahveh para plasmar cosas por escrito antes incluso de su ascenso al Monte Sinaí para recibir las tablillas. La primera vez fue después de la guerra con los amalecitas, una tribu que, en lugar de comportarse como aliada, traicionó a los israelitas y los atacó. Dios dijo que esta traición debería ser recordada por todas las generaciones futuras: "
Y Yahveh dijo a Moisés: escribe esto en un libro, como recordatorio" (Éxodo 17,14).

La segunda mención de un libro de escritos ocurre en el Éxodo 24,4 y 24,7, donde se dice que después de que el Señor Dios, hablando con una voz atronadora desde la cima del monte, hiciera una relación de las condiciones para una alianza imperecedera entre Él y los Hijos de Israel, "Moisés escribió todas las palabras de Yahveh, y construyó un altar a los pies del Monte, y erigió doce pilares de piedra, según el número de las tribus de Israel". Y después, "tomó el libro de la alianza y leyó de él al pueblo para que escuchara".

Zecharia Sitchin Anunnaki Nibiru Libro Codigo Cosmico Capitulo 7

Así pues, lo de dictar y lo de escribir comenzó antes de los ascensos de Moisés a la cima de la montaña y de la escritura de las dos series de tablillas. Pero hay que mirar a los primeros capítulos del Éxodo para averiguar cuándo y dónde pudo tener lugar la innovación alfabética, la lengua y la escritura empleada en las comunicaciones del Señor con Moisés.

En esos capítulos leemos que Moisés, adoptado como hijo por la hija del faraón, huyó para salvar la vida después de matar a un oficial egipcio. Su destino fue la península del Sinaí, donde terminó viviendo con el sumo sacerdote de los madianitas (y casándose con su hija). Y un día, apacentando los rebaños, se introdujo en el desierto, donde estaba "el Monte de los Elohim", y allí le llamó Dios, a través de la zarza ardiente, y le dio la misión de llevar a su pueblo, los Hijos de Israel, fuera de Egipto.

Moisés volvió a Egipto tras la muerte del faraón que le había sentenciado (Tutmosis III, según nuestros cálculos), en 1450 a.C., y forcejeó con el siguiente faraón (Amenofis II en nuestra opinión) durante siete años, hasta que se les permitió el Éxodo.

Habiendo empezado a oír del Señor Dios ya en el desierto, y después durante los siete años, hubo pues tiempo de sobra para innovar y dominar una nueva forma de escribir, una forma más simple y mucho más rápida que las de los grandes imperios de la época (el mesopotámico, el egipcio y el hitita).

Zecharia Sitchin Anunnaki Nibiru Libro Codigo Cosmico Capitulo 7

La Biblia habla de las extensas comunicaciones entre Yahveh y Moisés y Aarón desde el momento en que Moisés fue llamado a la zarza ardiente en adelante. Lo que no dice es si los mensajes divinos, que a veces suponían detalladas instrucciones, iban también por escrito; pero podría ser significativo que los "magos" de la corte del Faraón pensaran que habían sido instrucciones escritas: "Y los magos del faraón le dijeron a éste: Esto es el dedo de Dios" (Éxodo 8,15).

"El dedo de Dios", habrá que recordarlo, era el término utilizado en los textos egipcios concernientes al Dios Thot, para indicar algo escrito por el mismo Dios.

Si todo esto lleva a la sugerencia de que la escritura alfabética comenzó en la península del Sinaí, no debería de sorprender que los arqueólogos hayan llegado a las mismas conclusiones, pero sin ser capaces de explicar cómo pudo originarse en el desierto una innovación tan grande e ingeniosa.

¿Tuvo lugar en realidad la conversación que hemos imaginado, o fue el propio Moisés quien inventó el alfabeto? Después de todo, él estaba en la península del Sinaí en la misma época, tenía la elevada educación de la corte egipcia (donde se mantenía correspondencia tanto con los mesopotámicos como con los hititas), y no cabe duda de que aprendió la lengua semita de los madianitas (si no la conocía ya por sus hermanos israelitas de Egipto).

¿No vería Moisés, en sus andanzas por el desierto del Sinaí, a los esclavos semitas (israelitas que por entonces estaban esclavizados en Egipto) grabar toscamente en las paredes de las minas su idea de una nueva forma de escribir?

A uno le habría gustado ser capaz de atribuir la brillante innovación a Moisés, a él solo; hubiera sido gratificante acreditar al líder bíblico del Éxodo, el único que había conversado con Dios cara a cara según la Biblia, con la invención del alfabeto y la revolución cultural que desencadenó.

Pero las repetidas referencias a la Escritura Divina, en la que Dios mismo escribe, y Moisés sólo toma al dictado, sugieren que el sistema de lenguaje y escritura alfabética era uno de "los secretos de los dioses". De hecho, la Biblia le atribuye al mismo Yahveh la invención/innovación de otras lenguas y escrituras en una ocasión anterior, con posterioridad al incidente de la Torre de Babel.

De un modo u otro, creemos que Moisés fue el iniciado a través del cual se le reveló a la Humanidad la innovación. Y, por tanto, no nos equivocaríamos al llamarlo El Alfabeto Mosaico.

Pero hay más con respecto al primer alfabeto como "secreto de los dioses". En nuestra opinión, se basaba en los conocimientos más sofisticados y elevados: los del código genético.

Cuando los griegos adoptaron el alfabeto mosaico mil años más tarde (inviniéndolo como en la imagen de un espejo, Fig. 55), vieron la necesidad de añadir más letras con el fin de adaptarlo a sus necesidades de pronunciación. De hecho, dentro de los confines de las veintidós letras del alfabeto mosaico-semita, algunas se pueden pronunciar como "suaves" (V, J, S, Th) o fuertes (B, K, SH, T); y otras letras podían desdoblarse como vocales.

De hecho, si reflexionamos sobre esta limitación a veintidós (ni una más, ni una menos), no podremos evitar recordar las constricciones aplicadas al número sagrado doce (que exigía el añadido o la reducción del número de deidades con el fin de mantener el "Círculo Olímpico" exactamente en doce).

¿Se aplicó este principio oculto (inspirado divinamente) a la restricción del alfabeto original a veintidós letras?

Zecharia Sitchin Anunnaki Nibiru Libro Codigo Cosmico Capitulo 7

Este número debería de resultarnos familiar en nuestros días, en nuestra época. ¡Es el número de los cromosomas humanos cuando fue creado El Adán, antes de la segunda manipulación genética que le añadió los cromosomas sexuales "Y" y "X"!

¿Acaso el Todopoderoso, que le reveló a Moisés el secreto del alfabeto, utilizó el código genético como código secreto del alfabeto? La respuesta parece ser que Sí. Si esta conclusión parece extravagante, echémosle un vistazo a la afirmación del Señor en Isaías 45,11: "Soy Yo el que creó las letras... Soy Yo el que hizo la Tierra y creó al Adán sobre ella", así dice Yahveh, el Santo de Israel.

Quienquiera que estuviera implicado en la creación del Hombre, estuvo implicado también en la creación de las letras que componen el alfabeto.

Los sistemas informáticos de hoy en día construyen palabras y números de sólo dos "letras", un sistema Sí-No de unos y ceros junto con un flujo de electrones On-Off (y de ahí llamado binario). Pero la atención ya ha cambiado al código genético de cuatro letras y a la velocidad, mucho mayor, con la cual tienen lugar las transacciones dentro de la célula viva.

Conceptualmente, el actual lenguaje informático, que se expresa en una secuencia tal como 0100110011110011000010100 etc. (y en innumerables variaciones que utilizan el "0" y el "1") se puede considerar como el lenguaje genético de un fragmento de ADN expresado como los nucleótidos CGTAGAATTCTGCGAACCTT y así sucesivamente, en una cadena de letras de ADN (que se disponen siempre en "palabras" de tres letras) unidas como pares-base en los cuales la A se une con la T, la C con la G. El problema consiste en cómo crear y leer los chips de ordenador que no están cubiertos con electrones "0" y "1", sino con bits de material genético.

Desde 1991, gracias a los avances hechos en diversas instituciones académicas, así como en empresas comerciales involucradas en tratamientos genéticos, se ha conseguido crear chips de silicona cubiertos de nucleótidos.

Comparando la velocidad y las capacidades de la Informática del ADN, como se le llama a la nueva ciencia, "la capacidad de almacenamiento de información del ADN es gigantesca", afirmaba una investigación publicada en la revista Science (octubre 1997).

Zecharia Sitchin Anunnaki Nibiru Libro Codigo Cosmico Capitulo 7

En la naturaleza, la información genética codificada en el ADN la decodifica, a la velocidad del rayo, un mensajero llamado ARN, que transcribe y recombina las "letras" del ADN en "palabras" de tres letras.

Se ha demostrado que estos agrupamientos de tres letras se hallan en el centro de todas las formas de vida sobre la Tierra, dado que deletrean química y biológicamente los veintidós aminoácidos cuyas cadenas forman las proteínas de las cuales consta toda la vida en la Tierra (y, probablemente, en cualquier parte del cosmos).

La Figura 56 ilustra esquemáticamente, y de un modo simplificado, cómo se decodifica una secuencia de ADN y se recombina en los aminoácidos Propralina (Pro), Serina (Ser), etc., por medio del código de palabras de tres letras para construir una proteína.

La rica y precisa lengua hebrea se basa en palabras "raíz" a partir de las cuales derivan verbos, sustantivos, adverbios, adjetivos, pronombres, tiempos, conjugaciones y todas las demás variantes gramaticales. Por motivos que nadie ha sido capaz de explicar, estas palabras raíz se componen de tres letras. Parece que todo parte del acadio, la lengua madre de todas las lenguas semitas, que estaba formada por sílabas, a veces sólo una, a veces dos, tres o más.

¿Podría ser que el motivo de las palabras raíz hebreas de tres letras se halle en la lengua-ADN de tres letras, la verdadera fuente, como hemos concluido, del mismo alfabeto?
Si es así, las palabras raíz de tres letras corroborarían esta conclusión.

"La vida y la muerte están en la lengua", afirma la Biblia en Proverbios 18,21.

Esta afirmación se ha tratado de forma alegórica. Quizá sea hora de tomarla literalmente: la lengua de la Biblia hebrea y el código genético de la vida (y la muerte) del ADN no son sino las dos caras de una misma moneda.

Los misterios codificados en su interior son más vastos de lo que uno podría imaginar; entre otros sorprendentes descubrimientos, se incluyen los secretos de la curación.

 

Esta sección ha sido construida con información tomada de la siguiente dirección en Internet:

http://www.bibliotecapleyades.net/sitchin/codigos/codcosm07.htm

 

- "El presente surge del pasado, el pasado es el futuro".
Zecharia Sitchin

- "Tanto la Biblia Hebrea como el Nuevo Testamento afirman que los secretos del futuro están arraigados en el pasado, que el destino de la Tierra está conectado en los cielos".
Zecharia Sitchin

Pasadofuturo.com Temas Recomendados Buenos
Temas Recomendados:
Pasadofuturo.com Temas Recomendados Buenos
 
Nueva Medicina Germanica NMG 5LB Leyes Biologicas Ojo Vista
Terapeutas Graduados, Certificados y Recomendados
 
Nueva Medicina Germanica NMG 5LB Leyes Biologicas Estudio Clases Particulares Presenciales Cursos Seminarios Formacion Estudiar Ciudad Mexico Escuela Formacion Octubre Intensivo
Escuela de las Leyes Biológicas en Ciudad de México
 
Nueva Medicina Germanica NMG 5LB Leyes Biologicas Articulos Pasadofuturo Andy
Nueva Medicina Germanica NMG 5LB Leyes Biologicas Estudio Online Pasadofuturo.com Formacion Escuela Curso Seminario Clases Virtuales Internet
Escuela Virtual de las Leyes Biológicas por Internet
Piramides Energeticas Energia Piramidal Venta Compra Pasadofuturo.com Salud Meditacion Comprar Vender Mexico
Venta de Pirámides Energéticas Salud y Meditación
Nueva Medicina Germanica NMG 5LB Leyes Biologicas Oido Humano Audicion
Todos los Detalles sobre el Oído Humano
Nuevo Novedades Pasadofuturo.com Temas Recomendados
Lo Más Visto en los Últimos 30 Días:
Pasadofuturo.com Mas Visto Paginas Visitadas Visitas
1
Nueva Medicina Germanica Hamer Leyes Biologicas NMG Tabas Organos Conflictos
2
Nueva Medicina Germanica Hamer Leyes Biologicas NMG Organos Ectodermo Corteza Cerebral
3
Nueva Medicina Germanica NMG 5LB Leyes Biologicas Descarga Gratuita Gratis Libros
4
Nueva Medicina Germanica Hamer Leyes Biologicas NMG Organos Mesodermo Nuevo Corteza Cerebral
5
Nueva Medicina Germanica Hamer Leyes Biologicas NMG Tabas Organos Conflictos
6
Piramides Energeticas Energia Piramidal Venta Compra Pasadofuturo.com Salud Meditacion Comprar Vender Mexico

Visitas por Países
en este Momento



Pasadofuturo.com Facebook Siguenos Contacto

website security

SSL Sitio Seguro Pasadofuturo.com HTTPS Seguridad Internet

Páginas Vistas por Países

Free counters!

Nueva Medicina Germanica Hamer Leyes Biologicas 5LB Clases Particulares Presenciales Escuela Aprender Estudiar Cursos Seminarios Conferencias Formacion Ciudad Mexico Profesional Medicina Salud Noviembre Intensivo

Nueva Medicina Germanica Hamer Leyes Biologicas 5LB Clases Particulares Presenciales Escuela Aprender Estudiar Cursos Seminarios Conferencias Formacion Ciudad Mexico Profesional Medicina Salud Noviembre Intensivo

Nueva Medicina Germanica Hamer Leyes Biologicas 5LB Clases Particulares Presenciales Escuela Aprender Estudiar Cursos Seminarios Conferencias Mexico Jalisco Guadalajara Formacion Profesional Medicina Salud Virtual Virtuales Internet

Nueva Medicina Germanica Hamer Leyes Biologicas 5LB Clases Particulares Presenciales Escuela Aprender Estudiar Cursos Seminarios Conferencias Mexico Jalisco Guadalajara Formacion Profesional Medicina Salud Consultas

Piramides Energeticas Pasadofuturo.com Energia Piramidal Venta Compra Salud Meditacion

Suscribete Boletin Semanal Pasadofuturo.com Gratis Suscripcion Gratuita